Putting DNA to Work
Genetic Disease
 Introduction
You are members of an elite medical investigation team. You have been called into action because there have been a high number of infant deaths in a remote community in New Mexico. It is unknown at this point what caused these deaths. Is it an infectious disease? Is it an inherited disease? You are being sent to investigate. Your tasks are to determine the cause of these deaths and what can be done to save the lives of other children in this community.
During the preliminary investigation it was discovered that all of the afflicted infants had two copies of the DNA sequence shown below. In addition, the parents of the infants all mentioned that their child had sweat that seemed to be saltier than normal. It is your task to discover the significance of this DNA sequence, determine how it relates to those with the disease, describe the symptoms of disease, and the possible treatments. You will need to prepare a report to inform the public officials of the outcome of your investigation.
TGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCT
GTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGA
TGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTG
CAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCA
AGAATTTCTTTAGCAAGAGCAGTATA
For this project you will break into groups of 4. As a team you will use the Koshland Science Museum website as a resource to investigate DNA technology and perform a computational analysis of the DNA sequence that was found in the sick infants to determine the cause of the deaths.
Next: Group Activity
| 
